Transcript: Mouse NM_053156.2

Mus musculus allantoicase (Allc), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Allc (94041)
Length:
1460
CDS:
133..1377

Additional Resources:

NCBI RefSeq record:
NM_053156.2
NBCI Gene record:
Allc (94041)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053156.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101424 CGACGTGGACATTTCTTACTT pLKO.1 414 CDS 100% 5.625 7.875 N Allc n/a
2 TRCN0000101420 GCTTCCAGTCACCAAGCTAAT pLKO.1 1152 CDS 100% 10.800 7.560 N Allc n/a
3 TRCN0000101421 CCTGAGTGAAGAAGATACAAT pLKO.1 477 CDS 100% 5.625 3.938 N Allc n/a
4 TRCN0000101422 CCAAGTCCATAGCAGATGGTT pLKO.1 872 CDS 100% 3.000 2.100 N Allc n/a
5 TRCN0000101423 GCACACTTTGGACATCCAAAT pLKO.1 829 CDS 100% 1.080 0.756 N Allc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053156.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.