Transcript: Mouse NM_053185.2

Mus musculus collagen, type IV, alpha 6 (Col4a6), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Col4a6 (94216)
Length:
6648
CDS:
258..5333

Additional Resources:

NCBI RefSeq record:
NM_053185.2
NBCI Gene record:
Col4a6 (94216)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053185.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090583 CCACACATCATTTGAGTCAAA pLKO.1 5689 3UTR 100% 4.950 6.930 N Col4a6 n/a
2 TRCN0000352279 CCACACATCATTTGAGTCAAA pLKO_005 5689 3UTR 100% 4.950 6.930 N Col4a6 n/a
3 TRCN0000090586 CCAGGAATTGTCATCGGAGAT pLKO.1 3891 CDS 100% 4.050 5.670 N Col4a6 n/a
4 TRCN0000352277 CCAGGAATTGTCATCGGAGAT pLKO_005 3891 CDS 100% 4.050 5.670 N Col4a6 n/a
5 TRCN0000090585 CCTGGAGATAAAGGAGTAGAT pLKO.1 2154 CDS 100% 4.950 3.465 N Col4a6 n/a
6 TRCN0000352201 CCTGGAGATAAAGGAGTAGAT pLKO_005 2154 CDS 100% 4.950 3.465 N Col4a6 n/a
7 TRCN0000084134 CCTGGTTTACATGGACTGAAT pLKO.1 3768 CDS 100% 4.950 3.465 N COL4A6 n/a
8 TRCN0000286962 CCTGGTTTACATGGACTGAAT pLKO_005 3768 CDS 100% 4.950 3.465 N COL4A6 n/a
9 TRCN0000090584 GCCCTTCATATACTGCAACAT pLKO.1 4823 CDS 100% 4.950 3.465 N Col4a6 n/a
10 TRCN0000352278 GCCCTTCATATACTGCAACAT pLKO_005 4823 CDS 100% 4.950 3.465 N Col4a6 n/a
11 TRCN0000090587 CCAGTAGGATTTCCTGGGTTA pLKO.1 2967 CDS 100% 4.050 2.835 N Col4a6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053185.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.