Transcript: Mouse NM_053195.2

Mus musculus solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 (Slc24a3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc24a3 (94249)
Length:
3436
CDS:
57..1844

Additional Resources:

NCBI RefSeq record:
NM_053195.2
NBCI Gene record:
Slc24a3 (94249)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069895 CGGATCCTATATTCGGCTGAA pLKO.1 1622 CDS 100% 4.050 5.670 N Slc24a3 n/a
2 TRCN0000043801 CAACGTGTTCACCTTTGTGAA pLKO.1 1802 CDS 100% 0.495 0.693 N SLC24A3 n/a
3 TRCN0000436490 TGTCTGTGGTCGCACTCATTG pLKO_005 568 CDS 100% 10.800 8.640 N Slc24a3 n/a
4 TRCN0000069893 CGCTGAATTATTATGCAGAAT pLKO.1 3233 3UTR 100% 4.950 3.960 N Slc24a3 n/a
5 TRCN0000069894 GCTACTCAAGAAAGCCAATTT pLKO.1 791 CDS 100% 13.200 9.240 N Slc24a3 n/a
6 TRCN0000436219 AGCTGTTCACGTCGGTCATAG pLKO_005 391 CDS 100% 10.800 7.560 N Slc24a3 n/a
7 TRCN0000069896 CGTGTTCAACATCCTGTGCAT pLKO.1 464 CDS 100% 2.640 1.848 N Slc24a3 n/a
8 TRCN0000069897 CCACTGGGAGAAGTGGTTTAT pLKO.1 1322 CDS 100% 1.320 0.924 N Slc24a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.