Transcript: Mouse NM_053199.3

Mus musculus cell adhesion molecule 3 (Cadm3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cadm3 (94332)
Length:
4159
CDS:
202..1392

Additional Resources:

NCBI RefSeq record:
NM_053199.3
NBCI Gene record:
Cadm3 (94332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053199.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067436 CACTATTTGATCCGGCACAAA pLKO.1 1252 CDS 100% 4.950 6.930 N Cadm3 n/a
2 TRCN0000067437 CCAATCTTTCCCAGGACGATA pLKO.1 266 CDS 100% 4.950 6.930 N Cadm3 n/a
3 TRCN0000067435 GCCCTTCGAGATAATCGGATT pLKO.1 424 CDS 100% 4.050 5.670 N Cadm3 n/a
4 TRCN0000067434 CCACTCTAAATTGTCAGTCTT pLKO.1 638 CDS 100% 4.950 3.960 N Cadm3 n/a
5 TRCN0000067433 CCCTCCTGATACACCTGAAAT pLKO.1 3903 3UTR 100% 13.200 9.240 N Cadm3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053199.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08772 pDONR223 100% 88.7% 94.4% None (many diffs) n/a
2 ccsbBroad304_08772 pLX_304 0% 88.7% 94.4% V5 (many diffs) n/a
Download CSV