Transcript: Mouse NM_053235.2

Mus musculus vomeronasal 1 receptor 13 (Vmn1r13), mRNA.

Source:
NCBI, updated 2018-05-26
Taxon:
Mus musculus (mouse)
Gene:
Vmn1r13 (113862)
Length:
903
CDS:
1..903

Additional Resources:

NCBI RefSeq record:
NM_053235.2
NBCI Gene record:
Vmn1r13 (113862)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053235.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120186 CTGCTCAATCTTGCCAATGAA pLKO.1 489 CDS 100% 5.625 3.938 N Vmn1r13 n/a
2 TRCN0000120184 CCTGCTCAATCTTGCCAATGA pLKO.1 488 CDS 100% 4.950 3.465 N Vmn1r13 n/a
3 TRCN0000120185 GAATGGTTGTAACAGTGACAA pLKO.1 524 CDS 100% 4.950 3.465 N Vmn1r13 n/a
4 TRCN0000175437 CAAGCATCTTCATAGCATCAA pLKO.1 630 CDS 100% 4.950 2.475 Y Vmn1r6 n/a
5 TRCN0000215735 CATACATGGTGATTATCTTAT pLKO.1 590 CDS 100% 13.200 6.600 Y Vmn1r20 n/a
6 TRCN0000120181 GCAGACATATTTGAGTCACTA pLKO.1 184 CDS 100% 4.950 2.475 Y Vmn1r-ps8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053235.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.