Transcript: Mouse NM_053259.2

Mus musculus protease, serine 28 (Prss28), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Prss28 (114661)
Length:
1190
CDS:
162..986

Additional Resources:

NCBI RefSeq record:
NM_053259.2
NBCI Gene record:
Prss28 (114661)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053259.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032573 AGAGCTGTAAGCGGGCTTATA pLKO.1 727 CDS 100% 13.200 18.480 N Prss28 n/a
2 TRCN0000428749 AGCCTAAGAATGTACAGTTAC pLKO_005 300 CDS 100% 10.800 15.120 N Prss28 n/a
3 TRCN0000425582 ACAATCTGCCATCAATCTTCT pLKO_005 919 CDS 100% 4.950 3.465 N Prss28 n/a
4 TRCN0000032570 GATCCCAATTCAGGACAACAA pLKO.1 707 CDS 100% 4.950 3.465 N Prss28 n/a
5 TRCN0000032569 CCTCTGTATCTATCTCCAGAA pLKO.1 217 CDS 100% 4.050 2.835 N Prss28 n/a
6 TRCN0000032572 CTGTCTGGAAAGTACCGTGTT pLKO.1 191 CDS 100% 4.050 2.835 N Prss28 n/a
7 TRCN0000032571 CAACGATGTTAGTAAGAGGTT pLKO.1 509 CDS 100% 2.640 1.848 N Prss28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053259.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.