Transcript: Mouse NM_054063.4

Mus musculus pregnancy-specific glycoprotein 28 (Psg28), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Psg28 (114871)
Length:
1979
CDS:
191..1609

Additional Resources:

NCBI RefSeq record:
NM_054063.4
NBCI Gene record:
Psg28 (114871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_054063.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065775 GACAAATTTGAGACATGCAAT pLKO.1 403 CDS 100% 4.950 3.465 N Psg28 n/a
2 TRCN0000216075 CTTAGCACTCAGGACTTTAAA pLKO.1 1115 CDS 100% 15.000 7.500 Y Psg26 n/a
3 TRCN0000177815 CGGCAGAGAGACATTATACAT pLKO.1 466 CDS 100% 5.625 2.813 Y Psg26 n/a
4 TRCN0000065777 CCAAAGTATCTTCAATCACTT pLKO.1 716 CDS 100% 4.950 2.475 Y Psg28 n/a
5 TRCN0000176467 CCAAAGTATCTTCAATCACTT pLKO.1 716 CDS 100% 4.950 2.475 Y Psg26 n/a
6 TRCN0000065773 CCAGAGAATCTTCTAGTGTTT pLKO.1 365 CDS 100% 4.950 2.475 Y Psg28 n/a
7 TRCN0000177597 CCAGAGAATCTTCTAGTGTTT pLKO.1 365 CDS 100% 4.950 2.475 Y Psg26 n/a
8 TRCN0000065776 CCATAAGTAAACAAGGAGAAA pLKO.1 549 CDS 100% 4.950 2.475 Y Psg28 n/a
9 TRCN0000065774 CCTGGTACAAAGGTGTGCTTA pLKO.1 1098 CDS 100% 4.950 2.475 Y Psg28 n/a
10 TRCN0000198585 CCAGGTCTATAATCTGCCAAA pLKO.1 1060 CDS 100% 4.050 2.025 Y Psg27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_054063.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.