Transcript: Mouse NM_080445.4

Mus musculus UDP-Gal:betaGal beta 1,3-galactosyltransferase, polypeptide 6 (B3galt6), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
B3galt6 (117592)
Length:
3213
CDS:
63..1040

Additional Resources:

NCBI RefSeq record:
NM_080445.4
NBCI Gene record:
B3galt6 (117592)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080445.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018809 CGCTTCGACACGGAGTACAAA pLKO.1 831 CDS 100% 5.625 7.875 N B3galt6 n/a
2 TRCN0000018810 CTGCGGCACCACTCTGTTGTA pLKO.1 125 CDS 100% 1.650 2.310 N B3galt6 n/a
3 TRCN0000018807 CGAGGCTGCAACAATCAGTAT pLKO.1 855 CDS 100% 4.950 3.960 N B3galt6 n/a
4 TRCN0000035594 CTGGCAACTCTGCGACTACTA pLKO.1 656 CDS 100% 4.950 3.465 N B3GALT6 n/a
5 TRCN0000018808 GTTGCGCCTTTCCTATGTCTA pLKO.1 965 CDS 100% 4.950 3.465 N B3galt6 n/a
6 TRCN0000018811 GCAACAGATGTTGCTGCATGA pLKO.1 917 CDS 100% 0.405 0.284 N B3galt6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080445.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.