Transcript: Mouse NM_080446.2

Mus musculus helicase (DNA) B (Helb), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Helb (117599)
Length:
4540
CDS:
104..3328

Additional Resources:

NCBI RefSeq record:
NM_080446.2
NBCI Gene record:
Helb (117599)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080446.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178564 CGTCGCAAATGCAGAAATAAA pLKO.1 1375 CDS 100% 15.000 21.000 N Helb n/a
2 TRCN0000285943 ACGCTGTGCCAGGTCAATTAC pLKO_005 1715 CDS 100% 13.200 18.480 N Helb n/a
3 TRCN0000277305 GAACGTCCTGGCGTCAATTAG pLKO_005 1219 CDS 100% 13.200 18.480 N Helb n/a
4 TRCN0000176637 CCTGATCCTAAACATAACTTT pLKO.1 4364 3UTR 100% 5.625 7.875 N Helb n/a
5 TRCN0000285945 CCTGATCCTAAACATAACTTT pLKO_005 4364 3UTR 100% 5.625 7.875 N Helb n/a
6 TRCN0000217489 GTCTATCCCTGATGAGTATAC pLKO.1 283 CDS 100% 10.800 8.640 N Helb n/a
7 TRCN0000182657 GCCCAGTATTGAACCTGGTAA pLKO.1 1918 CDS 100% 4.950 3.960 N Helb n/a
8 TRCN0000277304 GCCCAGTATTGAACCTGGTAA pLKO_005 1918 CDS 100% 4.950 3.960 N Helb n/a
9 TRCN0000216372 GAAGAATGCATTGGTCATATA pLKO.1 943 CDS 100% 13.200 9.240 N Helb n/a
10 TRCN0000178366 GAGGATAACCTACAGAGAAAT pLKO.1 844 CDS 100% 13.200 9.240 N Helb n/a
11 TRCN0000277258 GAGGATAACCTACAGAGAAAT pLKO_005 844 CDS 100% 13.200 9.240 N Helb n/a
12 TRCN0000216896 GGACATTGACGTGGTCATTTA pLKO.1 1087 CDS 100% 13.200 9.240 N Helb n/a
13 TRCN0000198621 CTGTTAACGATGACGTGGATA pLKO.1 3057 CDS 100% 4.950 3.465 N Helb n/a
14 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 4175 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080446.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.