Transcript: Mouse NM_080466.2

Mus musculus potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 (Kcnn3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Kcnn3 (140493)
Length:
7617
CDS:
306..2504

Additional Resources:

NCBI RefSeq record:
NM_080466.2
NBCI Gene record:
Kcnn3 (140493)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069197 CGAAAGCTCGAACTCACCAAA pLKO.1 1938 CDS 100% 4.950 6.930 N Kcnn3 n/a
2 TRCN0000069194 CGTGGACATTATTCTGTCCAT pLKO.1 1514 CDS 100% 0.264 0.370 N Kcnn3 n/a
3 TRCN0000069193 CCCTGGAGAGTACAAGTTCTT pLKO.1 1442 CDS 100% 4.950 3.960 N Kcnn3 n/a
4 TRCN0000069196 GCTAAATCTCAATGACCACTT pLKO.1 695 CDS 100% 4.050 3.240 N Kcnn3 n/a
5 TRCN0000043897 TGAGTGACTATGCTCTGATTT pLKO.1 1156 CDS 100% 13.200 9.240 N KCNN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.