Transcript: Human NM_080474.2

Homo sapiens serpin family B member 12 (SERPINB12), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-03
Taxon:
Homo sapiens (human)
Gene:
SERPINB12 (89777)
Length:
3534
CDS:
1..1218

Additional Resources:

NCBI RefSeq record:
NM_080474.2
NBCI Gene record:
SERPINB12 (89777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080474.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416384 CGATCTTGGGTGGAGTTTAAT pLKO_005 1117 CDS 100% 15.000 21.000 N SERPINB12 n/a
2 TRCN0000052308 CGACGATTGAAAGTGTTGATT pLKO.1 419 CDS 100% 5.625 7.875 N SERPINB12 n/a
3 TRCN0000052311 CCTTTCTGTCTAAATGCGAAT pLKO.1 628 CDS 100% 4.050 5.670 N SERPINB12 n/a
4 TRCN0000052312 GCCATCTCACTCTAAAGATAA pLKO.1 774 CDS 100% 13.200 10.560 N SERPINB12 n/a
5 TRCN0000414277 AGGCAAAGATGATCGTCATAA pLKO_005 57 CDS 100% 13.200 9.240 N SERPINB12 n/a
6 TRCN0000427853 GTATTGCCAACAGGCTTTATG pLKO_005 338 CDS 100% 13.200 9.240 N SERPINB12 n/a
7 TRCN0000052310 GCACATCAGATTGATGAGGTA pLKO.1 151 CDS 100% 2.640 1.848 N SERPINB12 n/a
8 TRCN0000052309 GCTGTTTACTTCAAGGCCAAA pLKO.1 568 CDS 100% 4.050 2.430 N SERPINB12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080474.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14330 pDONR223 100% 95.2% 20.7% None 243_244ins61 n/a
2 ccsbBroad304_14330 pLX_304 0% 95.2% 20.7% V5 (not translated due to prior stop codon) 243_244ins61 n/a
Download CSV