Transcript: Mouse NM_080633.2

Mus musculus aconitase 2, mitochondrial (Aco2), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Aco2 (11429)
Length:
2785
CDS:
51..2393

Additional Resources:

NCBI RefSeq record:
NM_080633.2
NBCI Gene record:
Aco2 (11429)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080633.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114531 CCCATGCAACTGTATTTATTT pLKO.1 2626 3UTR 100% 15.000 21.000 N Aco2 n/a
2 TRCN0000326039 CCCATGCAACTGTATTTATTT pLKO_005 2626 3UTR 100% 15.000 21.000 N Aco2 n/a
3 TRCN0000114534 GCTCGCTACTACAAGAAACAT pLKO.1 1989 CDS 100% 5.625 7.875 N Aco2 n/a
4 TRCN0000326037 GCTCGCTACTACAAGAAACAT pLKO_005 1989 CDS 100% 5.625 7.875 N Aco2 n/a
5 TRCN0000056562 CCTGCTAGAGAAGAACATTAA pLKO.1 188 CDS 100% 13.200 9.240 N ACO2 n/a
6 TRCN0000333249 CCTGCTAGAGAAGAACATTAA pLKO_005 188 CDS 100% 13.200 9.240 N ACO2 n/a
7 TRCN0000114533 CCCAGTGAGTACATCCGATAT pLKO.1 165 CDS 100% 10.800 7.560 N Aco2 n/a
8 TRCN0000325968 CCCAGTGAGTACATCCGATAT pLKO_005 165 CDS 100% 10.800 7.560 N Aco2 n/a
9 TRCN0000114535 CCATACAACCACAGGATGAAA pLKO.1 942 CDS 100% 5.625 3.938 N Aco2 n/a
10 TRCN0000326038 CCATACAACCACAGGATGAAA pLKO_005 942 CDS 100% 5.625 3.938 N Aco2 n/a
11 TRCN0000114532 CCCTCCGACTATAACAAGATT pLKO.1 2184 CDS 100% 5.625 3.938 N Aco2 n/a
12 TRCN0000325965 CCCTCCGACTATAACAAGATT pLKO_005 2184 CDS 100% 5.625 3.938 N Aco2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080633.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.