Transcript: Human NM_080645.3

Homo sapiens collagen type XII alpha 1 chain (COL12A1), transcript variant short, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
COL12A1 (1303)
Length:
8233
CDS:
313..6012

Additional Resources:

NCBI RefSeq record:
NM_080645.3
NBCI Gene record:
COL12A1 (1303)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080645.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108413 CCTCCTTCATACACGATTATA pLKO.1 4540 CDS 100% 15.000 21.000 N COL12A1 n/a
2 TRCN0000108412 CCCTCCTTCATACACGATTAT pLKO.1 4539 CDS 100% 13.200 18.480 N COL12A1 n/a
3 TRCN0000108411 GCAGAAATATAGGATCACTTA pLKO.1 2160 CDS 100% 4.950 3.465 N COL12A1 n/a
4 TRCN0000091117 GCTGGAAATATAACAACTGAT pLKO.1 4849 CDS 100% 4.950 3.465 N Col12a1 n/a
5 TRCN0000335258 GCTGGAAATATAACAACTGAT pLKO_005 4849 CDS 100% 4.950 3.465 N Col12a1 n/a
6 TRCN0000108410 CCCAAGTATTTGTGCAATGAT pLKO.1 6945 3UTR 100% 5.625 3.375 N COL12A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080645.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.