Transcript: Human NM_130387.5

Homo sapiens ankyrin repeat and SOCS box containing 14 (ASB14), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
ASB14 (142686)
Length:
2199
CDS:
1..909

Additional Resources:

NCBI RefSeq record:
NM_130387.5
NBCI Gene record:
ASB14 (142686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_130387.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415977 TACGGATCTTGCTGCCATTAA pLKO_005 57 CDS 100% 13.200 18.480 N ASB14 n/a
2 TRCN0000438168 GCCGCCTAAAGATCCGGAAAT pLKO_005 758 CDS 100% 10.800 15.120 N ASB14 n/a
3 TRCN0000152228 CGAGTGATGCTTGATTATGTT pLKO.1 631 CDS 100% 5.625 7.875 N ASB14 n/a
4 TRCN0000151520 CTGGACATCTACAGTTATCAA pLKO.1 546 CDS 100% 5.625 7.875 N ASB14 n/a
5 TRCN0000428114 TCCATTACCCAATCGTCTAAA pLKO_005 825 CDS 100% 13.200 9.240 N ASB14 n/a
6 TRCN0000151317 GCCCTTCATTTGGAAATTCAA pLKO.1 1970 3UTR 100% 5.625 3.938 N ASB14 n/a
7 TRCN0000153587 GCACTGCAATACACTCTGAAA pLKO.1 421 CDS 100% 4.950 3.465 N ASB14 n/a
8 TRCN0000151256 GCTCTAAAGATACTGATTCCA pLKO.1 34 CDS 100% 3.000 2.100 N ASB14 n/a
9 TRCN0000154755 GATGCTGCTGAACTATGGGTA pLKO.1 459 CDS 100% 2.640 1.848 N ASB14 n/a
10 TRCN0000152088 CCTTTACAAAGAATACGACCT pLKO.1 855 CDS 100% 2.160 1.512 N ASB14 n/a
11 TRCN0000103956 GCTGGACATCTACAGTTATTA pLKO.1 545 CDS 100% 15.000 21.000 N Asb14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130387.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13212 pDONR223 100% 71.3% 64.3% None (many diffs) n/a
2 ccsbBroad304_13212 pLX_304 0% 71.3% 64.3% V5 (many diffs) n/a
Download CSV