Transcript: Human NM_130388.4

Homo sapiens ankyrin repeat and SOCS box containing 12 (ASB12), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ASB12 (142689)
Length:
1267
CDS:
170..1126

Additional Resources:

NCBI RefSeq record:
NM_130388.4
NBCI Gene record:
ASB12 (142689)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_130388.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435548 TATCCAGCTGTTAATCGATTT pLKO_005 886 CDS 100% 10.800 15.120 N ASB12 n/a
2 TRCN0000144717 GCGTTACAAACGTTTCATCAA pLKO.1 343 CDS 100% 4.950 6.930 N ASB12 n/a
3 TRCN0000141571 CCTGACCTCACAAGATGATAA pLKO.1 943 CDS 100% 13.200 10.560 N ASB12 n/a
4 TRCN0000140918 CCAGGAGCGTTACAAACGTTT pLKO.1 337 CDS 100% 4.950 3.960 N ASB12 n/a
5 TRCN0000139010 CTAAACTACCAGTCTGGGCAT pLKO.1 675 CDS 100% 2.160 1.728 N ASB12 n/a
6 TRCN0000424812 GAAATCTGCCTCCATCATAAT pLKO_005 851 CDS 100% 13.200 9.240 N ASB12 n/a
7 TRCN0000428692 TTGCGCTTGGCTGCTTCTTAT pLKO_005 398 CDS 100% 13.200 9.240 N ASB12 n/a
8 TRCN0000416698 TGTATGACAACGACTCCTATA pLKO_005 297 CDS 100% 10.800 7.560 N ASB12 n/a
9 TRCN0000142583 GCCAACGTCAAAGCTAAACTA pLKO.1 662 CDS 100% 5.625 3.938 N ASB12 n/a
10 TRCN0000140971 CCCATGTTGATTAGCTACCTA pLKO.1 1091 CDS 100% 3.000 2.100 N ASB12 n/a
11 TRCN0000141544 CCTCACAAGATGATAAAGGCA pLKO.1 948 CDS 100% 0.750 0.525 N ASB12 n/a
12 TRCN0000140644 GAGGCCAACGTCAAAGCTAAA pLKO.1 659 CDS 100% 10.800 6.480 N ASB12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130388.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.