Transcript: Mouse NM_130448.3

Mus musculus protocadherin 18 (Pcdh18), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pcdh18 (73173)
Length:
5168
CDS:
453..3857

Additional Resources:

NCBI RefSeq record:
NM_130448.3
NBCI Gene record:
Pcdh18 (73173)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_130448.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340666 GTTACTGCTTAGCATAGTTAA pLKO_005 4178 3UTR 100% 13.200 18.480 N Pcdh18 n/a
2 TRCN0000094263 CCATTGATACATTCGTTGCTA pLKO.1 1573 CDS 100% 3.000 4.200 N Pcdh18 n/a
3 TRCN0000340589 ATCGGTAATTGCTAGACTATC pLKO_005 575 CDS 100% 10.800 8.640 N Pcdh18 n/a
4 TRCN0000340587 CCGTTGTGCTGACCATCATTG pLKO_005 2134 CDS 100% 10.800 8.640 N Pcdh18 n/a
5 TRCN0000340586 TGCTGTGTTGCTGGTTATTAT pLKO_005 2582 CDS 100% 15.000 10.500 N Pcdh18 n/a
6 TRCN0000094260 GCACAATAATACTGCAGAAAT pLKO.1 2195 CDS 100% 13.200 9.240 N Pcdh18 n/a
7 TRCN0000094261 CCCGTCATTCCCATTGAGATA pLKO.1 870 CDS 100% 4.950 3.465 N Pcdh18 n/a
8 TRCN0000340588 ACCTTGCTCCTTGATCTAAAT pLKO_005 1239 CDS 100% 13.200 7.920 N Pcdh18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130448.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.