Transcript: Mouse NM_130455.2

Mus musculus glutamate receptor, ionotropic, NMDA3B (Grin3b), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Grin3b (170483)
Length:
3281
CDS:
177..3188

Additional Resources:

NCBI RefSeq record:
NM_130455.2
NBCI Gene record:
Grin3b (170483)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_130455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434127 GGTGCATGTGTCTCGGCATTT pLKO_005 1259 CDS 100% 10.800 15.120 N Grin3b n/a
2 TRCN0000434741 CGCCTTCATCATGGATAAATC pLKO_005 2396 CDS 100% 13.200 9.240 N Grin3b n/a
3 TRCN0000445900 ACCACTTGTCAGGGTTGTTTG pLKO_005 2662 CDS 100% 10.800 7.560 N Grin3b n/a
4 TRCN0000100224 GCTTCACACGAGCCAGAAGAT pLKO.1 2792 CDS 100% 4.950 3.465 N Grin3b n/a
5 TRCN0000100221 GTAAATTGTGAGGACCTGAAA pLKO.1 1137 CDS 100% 4.950 3.465 N Grin3b n/a
6 TRCN0000100223 AGTAAATTGTGAGGACCTGAA pLKO.1 1136 CDS 100% 4.050 2.835 N Grin3b n/a
7 TRCN0000100222 CCTTTGACTTTGAGCTCTATA pLKO.1 1651 CDS 100% 13.200 7.920 N Grin3b n/a
8 TRCN0000100220 GCTCCATGACAAGTGGTACAA pLKO.1 2582 CDS 100% 4.950 2.970 N Grin3b n/a
9 TRCN0000421865 ACCGTCTTCTCCTACTCCTCA pLKO_005 2010 CDS 100% 2.640 1.848 N GRIN3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.