Transcript: Mouse NM_130457.2

Mus musculus contactin associated protein-like 4 (Cntnap4), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cntnap4 (170571)
Length:
4863
CDS:
93..4025

Additional Resources:

NCBI RefSeq record:
NM_130457.2
NBCI Gene record:
Cntnap4 (170571)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_130457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434082 GATACGATACAAGCTAAATAA pLKO_005 3329 CDS 100% 15.000 21.000 N Cntnap4 n/a
2 TRCN0000094541 GCAGTGCAGTTCAGCCATATT pLKO.1 3606 CDS 100% 13.200 18.480 N Cntnap4 n/a
3 TRCN0000416673 GTCCAATAAGAGATATCATAT pLKO_005 703 CDS 100% 13.200 18.480 N Cntnap4 n/a
4 TRCN0000094542 CGCCTCGTTAATCAGCAAGAT pLKO.1 2160 CDS 100% 4.950 6.930 N Cntnap4 n/a
5 TRCN0000413556 CATTGATGCCCAGTATCATTG pLKO_005 2288 CDS 100% 10.800 7.560 N Cntnap4 n/a
6 TRCN0000094540 CCTGTCACTAAGATTGTGATT pLKO.1 2376 CDS 100% 4.950 3.465 N Cntnap4 n/a
7 TRCN0000094539 GCCTGGAAATGCTTCTGAGAT pLKO.1 4451 3UTR 100% 4.950 3.465 N Cntnap4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.