Transcript: Mouse NM_130859.2

Mus musculus caspase recruitment domain family, member 10 (Card10), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Card10 (105844)
Length:
4748
CDS:
59..3271

Additional Resources:

NCBI RefSeq record:
NM_130859.2
NBCI Gene record:
Card10 (105844)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_130859.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243877 ACCGGATCCAGCTGCAGTATT pLKO_005 1395 CDS 100% 13.200 18.480 N Card10 n/a
2 TRCN0000243878 TCGTCCCTCATCCCGTGTAAA pLKO_005 4496 3UTR 100% 13.200 18.480 N Card10 n/a
3 TRCN0000361903 GAAGCTCGGAAGAGCCAATTG pLKO_005 638 CDS 100% 10.800 15.120 N Card10 n/a
4 TRCN0000243876 TTTAGCAGCATGTCGGATATC pLKO_005 1817 CDS 100% 10.800 15.120 N Card10 n/a
5 TRCN0000243875 GAAGGACTGTGACCTCTATAA pLKO_005 1300 CDS 100% 13.200 9.240 N Card10 n/a
6 TRCN0000243879 AGAGCTAGAACGAAGCCTAAA pLKO_005 2644 CDS 100% 10.800 7.560 N Card10 n/a
7 TRCN0000361900 GAGATCAACCGGCTCTCTATC pLKO_005 1721 CDS 100% 10.800 7.560 N Card10 n/a
8 TRCN0000361904 TAGGCCTCCTCCATCAGATAC pLKO_005 3331 3UTR 100% 10.800 7.560 N Card10 n/a
9 TRCN0000361901 TGGCCTGGACTTCCTCAATAG pLKO_005 1945 CDS 100% 10.800 7.560 N Card10 n/a
10 TRCN0000175487 CAGTATTCTCAGAGCCTCATT pLKO.1 1409 CDS 100% 4.950 3.465 N Card10 n/a
11 TRCN0000173216 CCCAGGATAAGAGTCCAGATA pLKO.1 2016 CDS 100% 4.950 3.465 N Card10 n/a
12 TRCN0000194542 GCCTCAAGGATGAGAACTACA pLKO.1 807 CDS 100% 4.950 3.465 N Card10 n/a
13 TRCN0000173366 GCCTGACTCAGTTCTTGATGA pLKO.1 597 CDS 100% 4.950 3.465 N Card10 n/a
14 TRCN0000361949 TCTAGACCTCCTCCATCAGAT pLKO_005 3307 3UTR 100% 4.950 3.465 N Card10 n/a
15 TRCN0000173533 GCAGTATTCTCAGAGCCTCAT pLKO.1 1408 CDS 100% 4.050 2.835 N Card10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130859.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.