Transcript: Mouse NM_130885.2

Mus musculus oxidation resistance 1 (Oxr1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Oxr1 (170719)
Length:
4240
CDS:
149..2485

Additional Resources:

NCBI RefSeq record:
NM_130885.2
NBCI Gene record:
Oxr1 (170719)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_130885.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198261 GCCTGGATTCATAGTAGTCAA pLKO.1 1735 CDS 100% 4.950 6.930 N Oxr1 n/a
2 TRCN0000346008 GCCTGGATTCATAGTAGTCAA pLKO_005 1735 CDS 100% 4.950 6.930 N Oxr1 n/a
3 TRCN0000197650 CCCAATGAACTTGTTCAGTTA pLKO.1 239 CDS 100% 4.950 3.465 N Oxr1 n/a
4 TRCN0000298131 CCCAATGAACTTGTTCAGTTA pLKO_005 239 CDS 100% 4.950 3.465 N Oxr1 n/a
5 TRCN0000176903 GCCTACTTACATTTAGTTCTA pLKO.1 2935 3UTR 100% 4.950 3.465 N Oxr1 n/a
6 TRCN0000293127 GCCTACTTACATTTAGTTCTA pLKO_005 2935 3UTR 100% 4.950 3.465 N Oxr1 n/a
7 TRCN0000181476 CCTATGTCTCAGAGTCGGAAA pLKO.1 1534 CDS 100% 4.050 2.835 N Oxr1 n/a
8 TRCN0000293072 CCTATGTCTCAGAGTCGGAAA pLKO_005 1534 CDS 100% 4.050 2.835 N Oxr1 n/a
9 TRCN0000159728 GCATCGATTACATAAGTTCTT pLKO.1 1516 CDS 100% 4.950 3.465 N OXR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130885.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.