Transcript: Human NM_133170.4

Homo sapiens protein tyrosine phosphatase receptor type T (PTPRT), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
PTPRT (11122)
Length:
12679
CDS:
174..4556

Additional Resources:

NCBI RefSeq record:
NM_133170.4
NBCI Gene record:
PTPRT (11122)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133170.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355730 ACCGCAATAAGAATCGATATG pLKO_005 2965 CDS 100% 10.800 15.120 N PTPRT n/a
2 TRCN0000010659 CAGGGTGAAATGTGTGCGATA pLKO.1 3209 CDS 100% 4.050 5.670 N PTPRT n/a
3 TRCN0000220140 CCTCGATTCTCTACACTACTT pLKO.1 2144 CDS 100% 4.950 3.960 N PTPRT n/a
4 TRCN0000355731 AGTCGACTCTCCCAACTATAA pLKO_005 1190 CDS 100% 13.200 9.240 N PTPRT n/a
5 TRCN0000220141 CCGTTCTCTCTACTACAATAT pLKO.1 3698 CDS 100% 13.200 9.240 N PTPRT n/a
6 TRCN0000355729 TGCTTATTCCTACTCCTATTA pLKO_005 2549 CDS 100% 13.200 9.240 N PTPRT n/a
7 TRCN0000220143 CCCACGATGAACTTGCTCTTT pLKO.1 7249 3UTR 100% 4.950 3.465 N PTPRT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133170.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.