Transcript: Mouse NM_133203.5

Mus musculus killer cell lectin-like receptor, subfamily A, member 17 (Klra17), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Klra17 (170733)
Length:
1195
CDS:
142..963

Additional Resources:

NCBI RefSeq record:
NM_133203.5
NBCI Gene record:
Klra17 (170733)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133203.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068217 TGGCTTCTCATTTGATAAGAA pLKO.1 747 CDS 100% 5.625 3.938 N Klra17 n/a
2 TRCN0000068213 GTAAACAGATATGTGAGCATT pLKO.1 644 CDS 100% 4.950 3.465 N Klra17 n/a
3 TRCN0000068214 CTGAGGACAATCAAGGGTCAA pLKO.1 215 CDS 100% 4.050 2.835 N Klra17 n/a
4 TRCN0000068216 CCCAGGTGGAAGCCTGGAAAT pLKO.1 558 CDS 100% 0.360 0.216 N Klra17 n/a
5 TRCN0000068215 CATGTCCACATACAATGTAAA pLKO.1 819 CDS 100% 13.200 6.600 Y Klra17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133203.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.