Transcript: Mouse NM_133217.3

Mus musculus beta-carotene oxygenase 2 (Bco2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Bco2 (170752)
Length:
2093
CDS:
158..1756

Additional Resources:

NCBI RefSeq record:
NM_133217.3
NBCI Gene record:
Bco2 (170752)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133217.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076428 GCTGTTGTAGTTTGGACCTGA pLKO.1 1840 3UTR 100% 2.640 3.696 N Bco2 n/a
2 TRCN0000076429 GCCACCTACTATGACTGACAA pLKO.1 526 CDS 100% 4.950 3.960 N Bco2 n/a
3 TRCN0000076432 CCTTCTTACTACCATAGCTTT pLKO.1 860 CDS 100% 4.950 3.465 N Bco2 n/a
4 TRCN0000076431 CCCAGGAATGTACTACAGCAT pLKO.1 1048 CDS 100% 2.640 1.848 N Bco2 n/a
5 TRCN0000076430 GCCTTCTTACTACCATAGCTT pLKO.1 859 CDS 100% 3.000 1.800 N Bco2 n/a
6 TRCN0000064918 GCAAGTTTCTACAGAGTGATA pLKO.1 396 CDS 100% 4.950 3.465 N BCO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133217.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.