Transcript: Mouse NM_133222.3

Mus musculus adhesion G protein-coupled receptor L4 (Adgrl4), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Adgrl4 (170757)
Length:
4106
CDS:
102..2321

Additional Resources:

NCBI RefSeq record:
NM_133222.3
NBCI Gene record:
Adgrl4 (170757)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133222.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027463 CCATTGGGATTAAGGATTATA pLKO.1 1501 CDS 100% 15.000 21.000 N Adgrl4 n/a
2 TRCN0000027490 CCAGCGTGTCTAATCATTCTT pLKO.1 1977 CDS 100% 5.625 7.875 N Adgrl4 n/a
3 TRCN0000008253 CCCACATTATATGAACTTGAA pLKO.1 1278 CDS 100% 4.950 3.960 N ADGRL4 n/a
4 TRCN0000027466 CGGGATAATCATCTCCCTGAT pLKO.1 1547 CDS 100% 4.050 3.240 N Adgrl4 n/a
5 TRCN0000027493 GCCCACTTCAACTCAACTCTT pLKO.1 801 CDS 100% 4.950 3.465 N Adgrl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133222.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.