Transcript: Human NM_133267.3

Homo sapiens GS homeobox 2 (GSX2), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
GSX2 (170825)
Length:
1673
CDS:
183..1097

Additional Resources:

NCBI RefSeq record:
NM_133267.3
NBCI Gene record:
GSX2 (170825)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133267.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416796 GTTCACTAGCACGCAACTCCT pLKO_005 806 CDS 100% 2.640 3.696 N GSX2 n/a
2 TRCN0000016436 CGGAGGATTGAAATCGCCACT pLKO.1 873 CDS 100% 2.160 3.024 N GSX2 n/a
3 TRCN0000016435 CGGGTGAACCATGCGCATCAT pLKO.1 543 CDS 100% 1.650 2.310 N GSX2 n/a
4 TRCN0000426516 CGCTCATCATCAAGGACACCT pLKO_005 208 CDS 100% 2.640 1.848 N GSX2 n/a
5 TRCN0000016437 GAGATTCCACTGCCTCACCAT pLKO.1 734 CDS 100% 2.640 1.848 N GSX2 n/a
6 TRCN0000016433 CCGGATTTCTTCATCCCGCTT pLKO.1 267 CDS 100% 2.160 1.512 N GSX2 n/a
7 TRCN0000418908 CCCATTGGTGATGTCCGTGTC pLKO_005 299 CDS 100% 0.750 0.525 N GSX2 n/a
8 TRCN0000070676 GCCGGATTTCTTCATCCCGCT pLKO.1 266 CDS 100% 0.180 0.126 N Gsx2 n/a
9 TRCN0000016434 GAGAGAATTCTCTTCCAACAT pLKO.1 836 CDS 100% 0.000 0.000 N GSX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133267.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.