Transcript: Human NM_133448.3

Homo sapiens transmembrane protein 132D (TMEM132D), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TMEM132D (121256)
Length:
6135
CDS:
687..3986

Additional Resources:

NCBI RefSeq record:
NM_133448.3
NBCI Gene record:
TMEM132D (121256)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133448.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140645 GCGCACGGATTATACTGGAAA pLKO.1 1727 CDS 100% 4.950 6.930 N TMEM132D n/a
2 TRCN0000143785 GCTTTCAGTAACGTCCTCATA pLKO.1 5959 3UTR 100% 4.950 6.930 N TMEM132D n/a
3 TRCN0000431698 GATCGCATCCATGGATCAATG pLKO_005 4395 3UTR 100% 10.800 8.640 N TMEM132D n/a
4 TRCN0000430288 TGAGTAGCGAGGATGACATTA pLKO_005 3886 CDS 100% 13.200 9.240 N TMEM132D n/a
5 TRCN0000433842 TGTCTTGCTTAAGAGGTTTAT pLKO_005 4183 3UTR 100% 13.200 9.240 N TMEM132D n/a
6 TRCN0000144382 CCATTTGGATTCACCAACAAA pLKO.1 1032 CDS 100% 5.625 3.938 N TMEM132D n/a
7 TRCN0000145138 GAACGGCAAACATCAAAGTTA pLKO.1 3052 CDS 100% 5.625 3.938 N TMEM132D n/a
8 TRCN0000140013 GCTCACTCCAAGGTAGAGAAT pLKO.1 5464 3UTR 100% 4.950 3.465 N TMEM132D n/a
9 TRCN0000122112 CCCAGGATTTAATGCTACCTT pLKO.1 1006 CDS 100% 3.000 2.100 N TMEM132D n/a
10 TRCN0000144776 CTTGATAAACTGTGTGACCTT pLKO.1 3488 CDS 100% 2.640 1.584 N TMEM132D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133448.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09467 pDONR223 100% 99.9% 99.9% None 2492C>T n/a
Download CSV