Transcript: Human NM_133625.6

Homo sapiens synapsin II (SYN2), transcript variant IIa, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
SYN2 (6854)
Length:
3320
CDS:
165..1913

Additional Resources:

NCBI RefSeq record:
NM_133625.6
NBCI Gene record:
SYN2 (6854)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133625.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416403 CAACTCACTGGAATCCATATA pLKO_005 803 CDS 100% 13.200 18.480 N SYN2 n/a
2 TRCN0000424353 CCATGTCAGACAGGTACAAAC pLKO_005 1207 CDS 100% 10.800 7.560 N SYN2 n/a
3 TRCN0000147125 CAACAACTACAAGGCTTACAT pLKO.1 1124 CDS 100% 5.625 3.938 N SYN2 n/a
4 TRCN0000148561 CCCTCTCATTGAACAGACATA pLKO.1 896 CDS 100% 4.950 3.465 N SYN2 n/a
5 TRCN0000149623 GCCTTTCATTGACTCCAAGTA pLKO.1 1079 CDS 100% 4.950 3.465 N SYN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133625.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.