Transcript: Mouse NM_133626.2

Mus musculus ribosome binding protein 1 (Rrbp1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rrbp1 (81910)
Length:
2706
CDS:
287..2392

Additional Resources:

NCBI RefSeq record:
NM_133626.2
NBCI Gene record:
Rrbp1 (81910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133626.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173209 CGTTGGAAACACCTGTATGAA pLKO.1 2466 3UTR 100% 5.625 3.938 N Rrbp1 n/a
2 TRCN0000174028 CCACCAGAAAGGAGAGAAGAA pLKO.1 445 CDS 100% 4.950 3.465 N Rrbp1 n/a
3 TRCN0000174037 CCATCCAGGTTCTTGCTTCAA pLKO.1 762 CDS 100% 4.950 3.465 N Rrbp1 n/a
4 TRCN0000175751 GCAGTCAGTTCTATTGTGAAT pLKO.1 740 CDS 100% 4.950 3.465 N Rrbp1 n/a
5 TRCN0000194406 CCTAATGGGAAGATACCTGAA pLKO.1 521 CDS 100% 4.050 2.835 N Rrbp1 n/a
6 TRCN0000175851 GAAAGACAGATACAGTTGCTA pLKO.1 2085 CDS 100% 3.000 2.100 N Rrbp1 n/a
7 TRCN0000173780 CCTGCAAAGAAGAAGTCTGGT pLKO.1 2342 CDS 100% 2.640 1.848 N Rrbp1 n/a
8 TRCN0000193967 GTTCAAAGTCAGAGCAAGAAA pLKO.1 1979 CDS 100% 5.625 3.375 N Rrbp1 n/a
9 TRCN0000173754 CCCTAAGGACAGAAAGAAGAA pLKO.1 691 CDS 100% 4.950 2.970 N Rrbp1 n/a
10 TRCN0000117407 CCTAATGGGAAGATACCTGAT pLKO.1 521 CDS 100% 4.050 2.835 N RRBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133626.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.