Transcript: Mouse NM_133661.3

Mus musculus solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 (Slc6a12), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc6a12 (14411)
Length:
2563
CDS:
276..2162

Additional Resources:

NCBI RefSeq record:
NM_133661.3
NBCI Gene record:
Slc6a12 (14411)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133661.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070239 CCCTACCTGATGCTGATTATT pLKO.1 1053 CDS 100% 15.000 21.000 N Slc6a12 n/a
2 TRCN0000070241 CGAGTCTTATTTGAACATCTA pLKO.1 692 CDS 100% 4.950 3.960 N Slc6a12 n/a
3 TRCN0000070240 CGTTTCTATGACAACGTGGAA pLKO.1 1755 CDS 100% 2.640 2.112 N Slc6a12 n/a
4 TRCN0000070242 GCAAGTATACACCTCTCAAAT pLKO.1 1870 CDS 100% 13.200 9.240 N Slc6a12 n/a
5 TRCN0000070238 CCAGCCAAACAAGAACTCATT pLKO.1 2115 CDS 100% 4.950 3.465 N Slc6a12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133661.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.