Transcript: Mouse NM_133776.2

Mus musculus adhesion G protein-coupled receptor F1 (Adgrf1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Adgrf1 (77596)
Length:
3504
CDS:
290..3016

Additional Resources:

NCBI RefSeq record:
NM_133776.2
NBCI Gene record:
Adgrf1 (77596)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133776.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028718 GCTGATGTTTGGTTTATCATT pLKO.1 2192 CDS 100% 5.625 3.938 N Adgrf1 n/a
2 TRCN0000028671 CCCTCTCCTTATATCCATCAT pLKO.1 2410 CDS 100% 4.950 3.465 N Adgrf1 n/a
3 TRCN0000028698 GCCGAAATGCTTAAGGACATT pLKO.1 2902 CDS 100% 4.950 3.465 N Adgrf1 n/a
4 TRCN0000028674 GCCCACTACACAGTTGGAATT pLKO.1 809 CDS 100% 0.000 0.000 N Adgrf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133776.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.