Transcript: Mouse NM_133791.4

Mus musculus WW, C2 and coiled-coil domain containing 2 (Wwc2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Wwc2 (52357)
Length:
5042
CDS:
356..3919

Additional Resources:

NCBI RefSeq record:
NM_133791.4
NBCI Gene record:
Wwc2 (52357)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133791.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243855 CTTGTCCTGGACAGCGTATTT pLKO_005 2039 CDS 100% 13.200 18.480 N Wwc2 n/a
2 TRCN0000243853 CAGTACATCTGCAGGTTAAAT pLKO_005 3374 CDS 100% 15.000 12.000 N Wwc2 n/a
3 TRCN0000243852 CAGATCAGCCTGGCGGATTTA pLKO_005 2762 CDS 100% 13.200 10.560 N Wwc2 n/a
4 TRCN0000243851 GATGAATATGTGCGGTTAAAT pLKO_005 743 CDS 100% 15.000 10.500 N Wwc2 n/a
5 TRCN0000217167 CGCATCATAATGAGATCAAAC pLKO.1 4746 3UTR 100% 10.800 7.560 N Wwc2 n/a
6 TRCN0000243854 CTTCCGTTTCATACCAGTTTC pLKO_005 4070 3UTR 100% 10.800 7.560 N Wwc2 n/a
7 TRCN0000138322 CAGGGAGAAGATTGCCTACTT pLKO.1 3850 CDS 100% 4.950 3.465 N WWC2 n/a
8 TRCN0000216275 CCAAATATGATCCTGATATTT pLKO.1 825 CDS 100% 1.500 1.050 N Wwc2 n/a
9 TRCN0000191769 GCAGATCAAATTTAGCTGAAA pLKO.1 1248 CDS 100% 4.950 2.970 N Wwc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133791.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.