Transcript: Mouse NM_133829.2

Mus musculus major facilitator superfamily domain containing 6 (Mfsd6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mfsd6 (98682)
Length:
4770
CDS:
348..2732

Additional Resources:

NCBI RefSeq record:
NM_133829.2
NBCI Gene record:
Mfsd6 (98682)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133829.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248380 AGGCGTGTTAGTCAATTATTT pLKO_005 2126 CDS 100% 15.000 21.000 N Mfsd6 n/a
2 TRCN0000168779 GAGGCGTGTTAGTCAATTATT pLKO.1 2125 CDS 100% 15.000 21.000 N MFSD6 n/a
3 TRCN0000248379 TGTAATACAGCTCGCTATATT pLKO_005 1911 CDS 100% 15.000 21.000 N Mfsd6 n/a
4 TRCN0000216921 CTGTAATACAGCTCGCTATAT pLKO.1 1910 CDS 100% 13.200 18.480 N Mfsd6 n/a
5 TRCN0000216459 GGAATCGACTATACTCATATA pLKO.1 1389 CDS 100% 13.200 18.480 N Mfsd6 n/a
6 TRCN0000248381 GGAATCGACTATACTCATATA pLKO_005 1389 CDS 100% 13.200 18.480 N Mfsd6 n/a
7 TRCN0000173515 GCATAGTTCTTTGGGACGCAA pLKO.1 3387 3UTR 100% 2.640 3.696 N Mfsd6 n/a
8 TRCN0000216645 CTATGCTCTCTACCAAGTTAA pLKO.1 2453 CDS 100% 13.200 10.560 N Mfsd6 n/a
9 TRCN0000248378 CTATGCTCTCTACCAAGTTAA pLKO_005 2453 CDS 100% 13.200 10.560 N Mfsd6 n/a
10 TRCN0000173681 CCGCTACAACCACTTCAACAA pLKO.1 1529 CDS 100% 4.950 3.960 N Mfsd6 n/a
11 TRCN0000172298 CGGAGGCGTGTTAGTCAATTA pLKO.1 2123 CDS 100% 13.200 9.240 N MFSD6 n/a
12 TRCN0000193836 CCAGATTGTCTTCATCGTCTT pLKO.1 1460 CDS 100% 4.050 2.835 N Mfsd6 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2871 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133829.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.