Transcript: Mouse NM_133914.3

Mus musculus RAS p21 protein activator 4 (Rasa4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Rasa4 (54153)
Length:
2933
CDS:
198..2606

Additional Resources:

NCBI RefSeq record:
NM_133914.3
NBCI Gene record:
Rasa4 (54153)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133914.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027695 CCACGCTGGAATGAGACATTT pLKO.1 729 CDS 100% 13.200 9.240 N LOC381675 n/a
2 TRCN0000253097 GGTCCAGAACATAGGCAATAT pLKO_005 1712 CDS 100% 13.200 9.240 N Rasa4 n/a
3 TRCN0000267618 GCATCGTGAAGGTGGACAATG pLKO_005 286 CDS 100% 10.800 7.560 N Rasa4 n/a
4 TRCN0000267610 TAGGCAAAGTGGCGGTCAATG pLKO_005 832 CDS 100% 10.800 7.560 N Rasa4 n/a
5 TRCN0000253096 TTGTCCGAGTGCACTACAATG pLKO_005 667 CDS 100% 10.800 7.560 N Rasa4 n/a
6 TRCN0000027693 CGGAATGACTTTCTAGGCAAA pLKO.1 819 CDS 100% 4.050 2.835 N LOC381675 n/a
7 TRCN0000063700 TGCATCGTGAAGGTGGACAAT pLKO.1 285 CDS 100% 4.950 2.970 N RASA4 n/a
8 TRCN0000253095 TGTGACCCAGCATAGTCTTCT pLKO_005 2702 3UTR 100% 4.950 2.970 N Rasa4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133914.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.