Transcript: Mouse NM_133999.1

Mus musculus FIG4 phosphoinositide 5-phosphatase (Fig4), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Fig4 (103199)
Length:
3278
CDS:
190..2913

Additional Resources:

NCBI RefSeq record:
NM_133999.1
NBCI Gene record:
Fig4 (103199)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133999.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124711 CCAGTGTATGTGACCCTAATA pLKO.1 985 CDS 100% 13.200 18.480 N Fig4 n/a
2 TRCN0000313673 GCATTGATCCAAGTCCATTTA pLKO_005 2309 CDS 100% 13.200 18.480 N Fig4 n/a
3 TRCN0000124713 GCTGCCTTACGATGAAGTTAT pLKO.1 2121 CDS 100% 13.200 18.480 N Fig4 n/a
4 TRCN0000124710 GCCGTATGAATTGAGTAGTTT pLKO.1 2226 CDS 100% 5.625 7.875 N Fig4 n/a
5 TRCN0000313742 ATTGGAGGTCATGCAATTTAT pLKO_005 544 CDS 100% 15.000 10.500 N Fig4 n/a
6 TRCN0000349931 CGGTGAACTTCTGGATATAAT pLKO_005 882 CDS 100% 15.000 10.500 N Fig4 n/a
7 TRCN0000124712 CGCAGGCAGTTACTCTTCTTA pLKO.1 1131 CDS 100% 5.625 3.938 N Fig4 n/a
8 TRCN0000317324 CGCAGGCAGTTACTCTTCTTA pLKO_005 1131 CDS 100% 5.625 3.938 N Fig4 n/a
9 TRCN0000124709 CCAGGAATCCAGTGTTGTCTT pLKO.1 3029 3UTR 100% 4.950 2.970 N Fig4 n/a
10 TRCN0000317325 CCAGGAATCCAGTGTTGTCTT pLKO_005 3029 3UTR 100% 4.950 2.970 N Fig4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133999.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.