Transcript: Mouse NM_134137.2

Mus musculus leucyl-tRNA synthetase (Lars), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Lars (107045)
Length:
3845
CDS:
106..3642

Additional Resources:

NCBI RefSeq record:
NM_134137.2
NBCI Gene record:
Lars (107045)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253379 GCCGGTTGTGAAGGAGTTAAT pLKO_005 1149 CDS 100% 13.200 18.480 N Lars n/a
2 TRCN0000253380 CTCCCTATGCTGACCATTAAA pLKO_005 1234 CDS 100% 15.000 10.500 N Lars n/a
3 TRCN0000253378 CTGTACTGGTATGCCTATTAA pLKO_005 384 CDS 100% 15.000 10.500 N Lars n/a
4 TRCN0000253377 CGGATACTTCTGCTCCGAGAA pLKO_005 3675 3UTR 100% 4.050 2.835 N Lars n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03323 pDONR223 100% 85.8% 90% None (many diffs) n/a
2 ccsbBroad304_03323 pLX_304 0% 85.8% 90% V5 (many diffs) n/a
Download CSV