Transcript: Mouse NM_134200.1

Mus musculus vomeronasal 1 receptor 237 (Vmn1r237), mRNA.

Source:
NCBI, updated 2015-08-05
Taxon:
Mus musculus (mouse)
Gene:
Vmn1r237 (171234)
Length:
870
CDS:
1..870

Additional Resources:

NCBI RefSeq record:
NM_134200.1
NBCI Gene record:
Vmn1r237 (171234)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240433 CCTTCTTAGTCTACCATTATC pLKO_005 71 CDS 100% 13.200 18.480 N LOC100044269 n/a
2 TRCN0000174898 GCCCTGTCATTCTTAGTAAAT pLKO.1 409 CDS 100% 13.200 10.560 N Vmn1r237 n/a
3 TRCN0000175183 CAATGCAGTATTACTCTCTAT pLKO.1 540 CDS 100% 4.950 3.960 N Vmn1r237 n/a
4 TRCN0000240434 CCAGGTGGACACAGCTTAAAG pLKO_005 344 CDS 100% 13.200 9.240 N LOC100044269 n/a
5 TRCN0000240435 CTCGATGACATTGGTTGTAAA pLKO_005 226 CDS 100% 13.200 9.240 N LOC100044269 n/a
6 TRCN0000240431 TGATTGTAGCCAACTTCTTAA pLKO_005 149 CDS 100% 13.200 9.240 N LOC100044269 n/a
7 TRCN0000429364 GAACATGGCTTCAGTAGTTAC pLKO_005 804 CDS 100% 10.800 7.560 N Vmn1r237 n/a
8 TRCN0000434092 GATTGTAGCCAACTTCTTAAC pLKO_005 150 CDS 100% 10.800 7.560 N Vmn1r237 n/a
9 TRCN0000240432 TACATGAGGTGCAGACTAAAG pLKO_005 103 CDS 100% 10.800 7.560 N LOC100044269 n/a
10 TRCN0000412943 TCGATGACATTGGTTGTAAAC pLKO_005 227 CDS 100% 10.800 7.560 N Vmn1r237 n/a
11 TRCN0000175207 CCATTATCTGATGCTTTACTA pLKO.1 84 CDS 100% 5.625 3.938 N Vmn1r237 n/a
12 TRCN0000174009 GCCAAGTCTCCCAGTTACATT pLKO.1 364 CDS 100% 5.625 3.938 N Vmn1r237 n/a
13 TRCN0000173961 GTGTCTGCCTTTGGGTTGAAA pLKO.1 199 CDS 100% 5.625 3.375 N Vmn1r237 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.