Transcript: Human NM_138295.4

Homo sapiens polycystin 1 like 1, transient receptor potential channel interacting (PKD1L1), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
PKD1L1 (168507)
Length:
9092
CDS:
52..8601

Additional Resources:

NCBI RefSeq record:
NM_138295.4
NBCI Gene record:
PKD1L1 (168507)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138295.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244048 GATGCCAGTGTAGGCTATTTA pLKO_005 5011 CDS 100% 15.000 21.000 N PKD1L1 n/a
2 TRCN0000244045 TAATAGGCAGTTCCGTAATTA pLKO_005 7169 CDS 100% 15.000 21.000 N PKD1L1 n/a
3 TRCN0000146795 CCTAGCTCGAAATTCTGATAA pLKO.1 894 CDS 100% 13.200 18.480 N PKD1L1 n/a
4 TRCN0000147328 GCAAATCTGTTAGACGAACTT pLKO.1 8428 CDS 100% 4.950 6.930 N PKD1L1 n/a
5 TRCN0000244046 AGTGGAGCTTGGGCCTTATTA pLKO_005 1332 CDS 100% 15.000 12.000 N PKD1L1 n/a
6 TRCN0000244047 AGTTGCCCTAGAGTTACATAT pLKO_005 8875 3UTR 100% 13.200 9.240 N PKD1L1 n/a
7 TRCN0000244049 TGGCCATCCTAGCTCGAAATT pLKO_005 887 CDS 100% 13.200 9.240 N PKD1L1 n/a
8 TRCN0000147645 GCAGTGAACTATACAGTACAT pLKO.1 5086 CDS 100% 4.950 3.465 N PKD1L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138295.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.