Transcript: Human NM_138384.4

Homo sapiens mitochondrial ribosome associated GTPase 1 (MTG1), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
MTG1 (92170)
Length:
3424
CDS:
65..1069

Additional Resources:

NCBI RefSeq record:
NM_138384.4
NBCI Gene record:
MTG1 (92170)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138384.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235035 ACGGGTAACGTGAACATTATT pLKO_005 926 CDS 100% 15.000 21.000 N MTG1 n/a
2 TRCN0000235033 AGTACTGTATCATGGTCATTG pLKO_005 492 CDS 100% 10.800 15.120 N MTG1 n/a
3 TRCN0000150239 GAGTACTGTATCATGGTCATT pLKO.1 491 CDS 100% 4.950 6.930 N MTG1 n/a
4 TRCN0000235032 GATGGACTTGGCGGATCTTAC pLKO_005 316 CDS 100% 10.800 8.640 N MTG1 n/a
5 TRCN0000235036 GCTGTCTCAGAAGGAGTTAAA pLKO_005 1347 3UTR 100% 13.200 9.240 N MTG1 n/a
6 TRCN0000235034 TGCTGTACACCCTCAACAAAC pLKO_005 783 CDS 100% 10.800 7.560 N MTG1 n/a
7 TRCN0000146550 CCAACTGTGTAAAGGATGAAA pLKO.1 396 CDS 100% 5.625 3.938 N MTG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138384.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14341 pDONR223 100% 89.6% 89.2% None 1_102del;877A>G;997T>A n/a
Download CSV