Transcript: Human NM_138410.4

Homo sapiens CKLF like MARVEL transmembrane domain containing 7 (CMTM7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CMTM7 (112616)
Length:
1856
CDS:
55..582

Additional Resources:

NCBI RefSeq record:
NM_138410.4
NBCI Gene record:
CMTM7 (112616)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138410.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338531 CTGCTGAAAGTGGCGCAAATG pLKO_005 193 CDS 100% 10.800 15.120 N CMTM7 n/a
2 TRCN0000137120 CGCCTACAGCTACTTTGAAGT pLKO.1 270 CDS 100% 4.950 6.930 N CMTM7 n/a
3 TRCN0000338457 CGCCTACAGCTACTTTGAAGT pLKO_005 270 CDS 100% 4.950 6.930 N CMTM7 n/a
4 TRCN0000135475 GTCACCATTTGCGACTTGATA pLKO.1 292 CDS 100% 5.625 4.500 N CMTM7 n/a
5 TRCN0000338528 GTCACCATTTGCGACTTGATA pLKO_005 292 CDS 100% 5.625 4.500 N CMTM7 n/a
6 TRCN0000133935 CCTGTCCTAATTTATCTAGCT pLKO.1 978 3UTR 100% 2.640 2.112 N CMTM7 n/a
7 TRCN0000338459 CCTGTCCTAATTTATCTAGCT pLKO_005 978 3UTR 100% 2.640 2.112 N CMTM7 n/a
8 TRCN0000136985 CAAATGGTCACCCTGCTGATT pLKO.1 208 CDS 100% 4.950 3.465 N CMTM7 n/a
9 TRCN0000134060 CAAAGCCCTGTCCTAATTTAT pLKO.1 972 3UTR 100% 15.000 9.000 N CMTM7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138410.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.