Transcript: Human NM_138420.4

Homo sapiens AHNAK nucleoprotein 2 (AHNAK2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
AHNAK2 (113146)
Length:
18335
CDS:
138..17525

Additional Resources:

NCBI RefSeq record:
NM_138420.4
NBCI Gene record:
AHNAK2 (113146)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138420.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245712 ACGCACAGAGGAAGGATTAAA pLKO_005 2018 CDS 100% 15.000 21.000 N AHNAK2 n/a
2 TRCN0000245714 GGTGCGAGTACACGATTTAAA pLKO_005 1586 CDS 100% 15.000 21.000 N AHNAK2 n/a
3 TRCN0000245711 TCAGGCAGAGTGCGGTATATT pLKO_005 17977 3UTR 100% 15.000 10.500 N AHNAK2 n/a
4 TRCN0000245710 AGTGTCCAGAGGCCAATATTG pLKO_005 16378 CDS 100% 13.200 9.240 N AHNAK2 n/a
5 TRCN0000245713 TTGGAATGGATTCGAAGTTTA pLKO_005 14215 CDS 100% 13.200 7.920 N AHNAK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138420.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13016 pDONR223 100% 8.3% 8.3% None 1_15936del;16189C>G n/a
2 ccsbBroad304_13016 pLX_304 0% 8.3% 8.3% V5 1_15936del;16189C>G n/a
3 TRCN0000465882 AAGGATTACATCCCCCTCATGGGT pLX_317 24.5% 8.3% 8.3% V5 1_15936del;16189C>G n/a
Download CSV