Transcript: Human NM_138576.4

Homo sapiens BAF chromatin remodeling complex subunit BCL11B (BCL11B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
BCL11B (64919)
Length:
8528
CDS:
980..3664

Additional Resources:

NCBI RefSeq record:
NM_138576.4
NBCI Gene record:
BCL11B (64919)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138576.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033481 CGGCGAGCACTTGCTGACTAA pLKO.1 3610 CDS 100% 1.650 2.310 N BCL11B n/a
2 TRCN0000433876 TCCCGTCCGAGAACGTGTACT pLKO_005 3084 CDS 100% 1.650 2.310 N BCL11B n/a
3 TRCN0000414002 CATGAAGACGCACGGGCAGAT pLKO_005 3505 CDS 100% 1.350 1.890 N BCL11B n/a
4 TRCN0000033479 CCAGCTACATTTGCACAACAT pLKO.1 1635 CDS 100% 4.950 3.960 N BCL11B n/a
5 TRCN0000432291 TGGAAACCCGAGGGTTGATTA pLKO_005 3826 3UTR 100% 13.200 9.240 N BCL11B n/a
6 TRCN0000433432 ATGACTCGCAAGCAATGTTAG pLKO_005 4031 3UTR 100% 10.800 7.560 N BCL11B n/a
7 TRCN0000238420 TGAGCCTTCCAGCTACATTTG pLKO_005 1627 CDS 100% 10.800 7.560 N Bcl11b n/a
8 TRCN0000437022 AGAGCAAGTCGTGCGAGTTCT pLKO_005 2253 CDS 100% 4.950 3.465 N BCL11B n/a
9 TRCN0000238421 AGATGCCCTTCAGCGTCTACA pLKO_005 3558 CDS 100% 4.950 3.465 N Bcl11b n/a
10 TRCN0000238419 CAAGTTCCAGAGCAATCTCAT pLKO_005 2287 CDS 100% 4.950 3.465 N Bcl11b n/a
11 TRCN0000033482 GTTCAAGAACTGCAGCAACTT pLKO.1 3391 CDS 100% 4.950 3.465 N BCL11B n/a
12 TRCN0000429728 AGTTCCAGAGCAATCTCATCG pLKO_005 2289 CDS 100% 4.050 2.835 N BCL11B n/a
13 TRCN0000441656 AGTCGAGCTTCAGCATGGACT pLKO_005 2637 CDS 100% 2.640 1.848 N BCL11B n/a
14 TRCN0000436190 CCAGATGCCCTTCAGCGTCTA pLKO_005 3556 CDS 100% 1.350 0.945 N BCL11B n/a
15 TRCN0000033483 GCTGGGCAAGGTCATGGAGAA pLKO.1 2761 CDS 100% 1.350 0.945 N BCL11B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138576.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.