Transcript: Mouse NM_138604.3

Mus musculus OTU domain containing 5 (Otud5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Otud5 (54644)
Length:
4259
CDS:
287..1987

Additional Resources:

NCBI RefSeq record:
NM_138604.3
NBCI Gene record:
Otud5 (54644)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113257 CCGTCATTTAAGCCAGGGTTT pLKO.1 1328 CDS 100% 4.050 5.670 N Otud5 n/a
2 TRCN0000113256 CGCTGATTACTTCTCCAACTA pLKO.1 1048 CDS 100% 4.950 3.960 N Otud5 n/a
3 TRCN0000317238 CGCTGATTACTTCTCCAACTA pLKO_005 1048 CDS 100% 4.950 3.960 N Otud5 n/a
4 TRCN0000143838 CAACAGGAATACCTAGACAGT pLKO.1 1919 CDS 100% 2.640 2.112 N OTUD5 n/a
5 TRCN0000313719 AGAAGACTTCACCACCTATAT pLKO_005 1075 CDS 100% 13.200 9.240 N Otud5 n/a
6 TRCN0000113255 CCTTCCTTAAAGATCAGATAA pLKO.1 2345 3UTR 100% 13.200 9.240 N Otud5 n/a
7 TRCN0000313716 TGTCAGCTACCACCGGAATAT pLKO_005 1249 CDS 100% 13.200 9.240 N Otud5 n/a
8 TRCN0000313717 ATCCTAACAAGGCCACTATTG pLKO_005 1290 CDS 100% 10.800 7.560 N Otud5 n/a
9 TRCN0000349925 GATGCCACCCAAACTTCTTTG pLKO_005 2038 3UTR 100% 10.800 7.560 N Otud5 n/a
10 TRCN0000113258 GCACAGAACCTATCAACACAT pLKO.1 1191 CDS 100% 4.950 3.465 N Otud5 n/a
11 TRCN0000113259 CCACATTGAAATGCAGGCTAT pLKO.1 1129 CDS 100% 4.050 2.835 N Otud5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.