Transcript: Human NM_138632.2

Homo sapiens TRIO and F-actin binding protein (TRIOBP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
TRIOBP (11078)
Length:
1743
CDS:
5..1300

Additional Resources:

NCBI RefSeq record:
NM_138632.2
NBCI Gene record:
TRIOBP (11078)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117085 CTCGGACTCTAACAAGGAGAA pLKO.1 556 CDS 100% 4.050 5.670 N TRIOBP n/a
2 TRCN0000288921 CTCGGACTCTAACAAGGAGAA pLKO_005 556 CDS 100% 4.050 5.670 N TRIOBP n/a
3 TRCN0000117086 CAGGTCTCAAAGGTGGGATTT pLKO.1 1278 CDS 100% 10.800 8.640 N TRIOBP n/a
4 TRCN0000308052 ATTTGGCTGTGTCTGGGAATA pLKO_005 1563 3UTR 100% 10.800 7.560 N TRIOBP n/a
5 TRCN0000117082 TGTCACAACTAGGACAAACTA pLKO.1 1592 3UTR 100% 5.625 3.938 N TRIOBP n/a
6 TRCN0000117084 CATTGGTTTGTGCTGACAGAT pLKO.1 293 CDS 100% 4.950 3.465 N TRIOBP n/a
7 TRCN0000117083 GCTGACAGATTCAAGTCTCAA pLKO.1 304 CDS 100% 4.950 3.465 N TRIOBP n/a
8 TRCN0000288920 GCTGACAGATTCAAGTCTCAA pLKO_005 304 CDS 100% 4.950 3.465 N TRIOBP n/a
9 TRCN0000308050 ACTGAGCTCTGAGAGGTTATG pLKO_005 1231 CDS 100% 10.800 6.480 N TRIOBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.