Transcript: Mouse NM_138677.2

Mus musculus ER degradation enhancer, mannosidase alpha-like 1 (Edem1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Edem1 (192193)
Length:
5858
CDS:
100..2058

Additional Resources:

NCBI RefSeq record:
NM_138677.2
NBCI Gene record:
Edem1 (192193)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018465 GCCCTTAAAGAGCATCTACAT pLKO.1 2004 CDS 100% 4.950 3.960 N Edem1 n/a
2 TRCN0000292840 GCCCTTAAAGAGCATCTACAT pLKO_005 2004 CDS 100% 4.950 3.960 N Edem1 n/a
3 TRCN0000018469 CCTTGGATACATTGGCAATAA pLKO.1 650 CDS 100% 13.200 9.240 N Edem1 n/a
4 TRCN0000292838 CCTTGGATACATTGGCAATAA pLKO_005 650 CDS 100% 13.200 9.240 N Edem1 n/a
5 TRCN0000018466 CGGAGCAACGATACAGGATTA pLKO.1 1102 CDS 100% 10.800 7.560 N Edem1 n/a
6 TRCN0000292911 CGGAGCAACGATACAGGATTA pLKO_005 1102 CDS 100% 10.800 7.560 N Edem1 n/a
7 TRCN0000018468 CCTTCCAATCTGAACATCAAT pLKO.1 592 CDS 100% 5.625 3.938 N Edem1 n/a
8 TRCN0000018467 CCATATCATATCTGTGGACAA pLKO.1 1827 CDS 100% 4.050 2.835 N Edem1 n/a
9 TRCN0000292909 CCATATCATATCTGTGGACAA pLKO_005 1827 CDS 100% 4.050 2.835 N Edem1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.