Transcript: Human NM_138691.2

Homo sapiens transmembrane channel like 1 (TMC1), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
TMC1 (117531)
Length:
3201
CDS:
541..2823

Additional Resources:

NCBI RefSeq record:
NM_138691.2
NBCI Gene record:
TMC1 (117531)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138691.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044457 GCCGTTATGTGCTGCAATGTT pLKO.1 2383 CDS 100% 5.625 7.875 N TMC1 n/a
2 TRCN0000425006 AGGTCATGCTGGCCAATTAAG pLKO_005 2952 3UTR 100% 13.200 10.560 N TMC1 n/a
3 TRCN0000044456 CGGACCAGAGATGTTATCAAT pLKO.1 670 CDS 100% 5.625 4.500 N TMC1 n/a
4 TRCN0000044453 GCTAACTTCTTCGTGTTTCTA pLKO.1 1642 CDS 100% 5.625 4.500 N TMC1 n/a
5 TRCN0000434979 AGCTAGTAAAGGCCAATATTA pLKO_005 1958 CDS 100% 15.000 10.500 N TMC1 n/a
6 TRCN0000436245 GCTGCTGGTCGCCAGTAATAA pLKO_005 2806 CDS 100% 15.000 10.500 N TMC1 n/a
7 TRCN0000419362 TGGGACTTGGAGTATGGATAT pLKO_005 2215 CDS 100% 10.800 7.560 N TMC1 n/a
8 TRCN0000044454 CCATCTATTATCTCAATGCTA pLKO.1 2675 CDS 100% 3.000 2.100 N TMC1 n/a
9 TRCN0000044455 GCTGAATTAGAAGACTACCAT pLKO.1 1822 CDS 100% 3.000 2.100 N TMC1 n/a
10 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 185 5UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138691.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.