Transcript: Mouse NM_139001.2

Mus musculus chondroitin sulfate proteoglycan 4 (Cspg4), mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Mus musculus (mouse)
Gene:
Cspg4 (121021)
Length:
8050
CDS:
87..7070

Additional Resources:

NCBI RefSeq record:
NM_139001.2
NBCI Gene record:
Cspg4 (121021)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348357 ACGCATCAGCCACCGTAAATG pLKO_005 6202 CDS 100% 13.200 18.480 N Cspg4 n/a
2 TRCN0000348358 GGGACAAGCGTGGCAACTTTA pLKO_005 820 CDS 100% 13.200 18.480 N Cspg4 n/a
3 TRCN0000348354 CAATACCCTACGCGTACTTTC pLKO_005 993 CDS 100% 10.800 15.120 N Cspg4 n/a
4 TRCN0000098337 GCATAGAAGATTTCAGTGTTA pLKO.1 1150 CDS 100% 4.950 6.930 N Cspg4 n/a
5 TRCN0000098336 CCCTATCTTCACGTAGCCAAT pLKO.1 3474 CDS 100% 4.050 5.670 N Cspg4 n/a
6 TRCN0000334788 CCCTATCTTCACGTAGCCAAT pLKO_005 3474 CDS 100% 4.050 5.670 N Cspg4 n/a
7 TRCN0000348279 GAACTGTGACCTTAGATAAAT pLKO_005 7353 3UTR 100% 15.000 10.500 N Cspg4 n/a
8 TRCN0000098338 GCAACCAACTTGTGGAACATT pLKO.1 6418 CDS 100% 5.625 3.938 N Cspg4 n/a
9 TRCN0000098339 CCGAACAGAATCTAGGAGCAA pLKO.1 6401 CDS 100% 2.640 1.848 N Cspg4 n/a
10 TRCN0000098335 CCTGAGGATCTCCAGAGCCAA pLKO.1 7137 3UTR 100% 0.880 0.528 N Cspg4 n/a
11 TRCN0000136528 CTTTGCCACTGAGCCTTACAA pLKO.1 6578 CDS 100% 5.625 3.938 N CSPG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.