Transcript: Human NM_139072.4

Homo sapiens delta/notch like EGF repeat containing (DNER), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
DNER (92737)
Length:
3257
CDS:
133..2346

Additional Resources:

NCBI RefSeq record:
NM_139072.4
NBCI Gene record:
DNER (92737)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_139072.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099741 GCGAGCTGTATTGATGCAAAT pLKO.1 1216 CDS 100% 10.800 15.120 N Dner n/a
2 TRCN0000152638 GCGAGCTGTATTGATGCAAAT pLKO.1 1216 CDS 100% 10.800 15.120 N DNER n/a
3 TRCN0000153248 GCGAGGCAAATTCTGATTGAT pLKO.1 2988 3UTR 100% 5.625 7.875 N DNER n/a
4 TRCN0000153047 GCATTGAATACCAGGGTTCTT pLKO.1 2129 CDS 100% 4.950 6.930 N DNER n/a
5 TRCN0000157848 CCAGAAGGATACTTCGGATCT pLKO.1 1387 CDS 100% 4.050 5.670 N DNER n/a
6 TRCN0000150759 GACTAAGTCTATTGTGGCTTT pLKO.1 999 CDS 100% 4.050 5.670 N DNER n/a
7 TRCN0000151770 CGAGGCAAATTCTGATTGATT pLKO.1 2989 3UTR 100% 5.625 3.938 N DNER n/a
8 TRCN0000158381 CCAGATATTGCCTGTGGGAAT pLKO.1 724 CDS 100% 4.050 2.835 N DNER n/a
9 TRCN0000152493 CCTTATTCTGTGCATGGGTAA pLKO.1 2847 3UTR 100% 4.050 2.835 N DNER n/a
10 TRCN0000156519 GCCTGGCAGAATACAAAGGAA pLKO.1 1724 CDS 100% 3.000 2.100 N DNER n/a
11 TRCN0000152030 CCCAGATTAATTTCTGTGGTT pLKO.1 2621 3UTR 100% 2.640 1.848 N DNER n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139072.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.