Transcript: Mouse NM_139227.4

Mus musculus ataxin 7 (Atxn7), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Atxn7 (246103)
Length:
6870
CDS:
272..2875

Additional Resources:

NCBI RefSeq record:
NM_139227.4
NBCI Gene record:
Atxn7 (246103)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139227.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104970 CGTGAGAAGTTTGTGTTTGTA pLKO.1 3134 3UTR 100% 5.625 7.875 N Atxn7 n/a
2 TRCN0000104973 GCAGATTGGAAGAGGTTATTA pLKO.1 1789 CDS 100% 15.000 12.000 N Atxn7 n/a
3 TRCN0000104971 GCCTCAACTGTGTGACAAATA pLKO.1 2481 CDS 100% 13.200 9.240 N Atxn7 n/a
4 TRCN0000104974 GCATTTCAATCTCACTATGAA pLKO.1 713 CDS 100% 5.625 3.938 N Atxn7 n/a
5 TRCN0000104972 GCAGGCATTTCAATCTCACTA pLKO.1 709 CDS 100% 4.950 3.465 N Atxn7 n/a
6 TRCN0000138947 GAGAGAGAGGAGAGAGAGAAA pLKO.1 5830 3UTR 100% 4.950 2.475 Y TVP23C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139227.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.