Transcript: Mouse NM_139228.3

Mus musculus rhomboid, veinlet-like 3 (Drosophila) (Rhbdl3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rhbdl3 (246104)
Length:
3767
CDS:
250..1464

Additional Resources:

NCBI RefSeq record:
NM_139228.3
NBCI Gene record:
Rhbdl3 (246104)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139228.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032638 CCTAGCCAACATTGTCATGAA pLKO.1 1113 CDS 100% 4.950 6.930 N Rhbdl3 n/a
2 TRCN0000032637 CGGCTACATCAGCACAGGAAA pLKO.1 402 CDS 100% 4.950 3.960 N Rhbdl3 n/a
3 TRCN0000032635 GCCCTGGTTCATGATCACAAT pLKO.1 735 CDS 100% 4.950 3.960 N Rhbdl3 n/a
4 TRCN0000032634 GCGCTATGTGACGTACATCTT pLKO.1 885 CDS 100% 4.950 3.960 N Rhbdl3 n/a
5 TRCN0000048626 AGGCATGAAGTGCCAGTTCAA pLKO.1 1140 CDS 100% 4.950 3.465 N RHBDL3 n/a
6 TRCN0000032636 GATCTGTATGAGTATGGAGTT pLKO.1 1185 CDS 100% 4.050 2.835 N Rhbdl3 n/a
7 TRCN0000048627 CACTGGAAAGTCCTGTTTGAT pLKO.1 361 CDS 100% 5.625 3.938 N RHBDL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139228.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.