Transcript: Human NM_139348.3

Homo sapiens bridging integrator 1 (BIN1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
BIN1 (274)
Length:
2154
CDS:
212..1660

Additional Resources:

NCBI RefSeq record:
NM_139348.3
NBCI Gene record:
BIN1 (274)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_139348.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307311 CCACTACGAGTCCCTTCAAAC pLKO_005 676 CDS 100% 10.800 15.120 N BIN1 n/a
2 TRCN0000294325 CGACCTGCTGTGGATGGATTA pLKO_005 532 CDS 100% 10.800 15.120 N BIN1 n/a
3 TRCN0000381666 GAACAGCCGCGTAGGTTTCTA pLKO_005 811 CDS 100% 5.625 7.875 N BIN1 n/a
4 TRCN0000118037 CTCCCAAAGATTAGGTCGTTT pLKO.1 1804 3UTR 100% 4.950 6.930 N BIN1 n/a
5 TRCN0000118039 CCCGACATCAAGTCACGCATT pLKO.1 611 CDS 100% 4.050 5.670 N BIN1 n/a
6 TRCN0000287039 CCCGACATCAAGTCACGCATT pLKO_005 611 CDS 100% 4.050 5.670 N BIN1 n/a
7 TRCN0000381542 GGTTTCATGTTCAAGGTACAG pLKO_005 1436 CDS 100% 4.050 5.670 N BIN1 n/a
8 TRCN0000381076 TGAGCAGTGCGTCCAGAATTT pLKO_005 343 CDS 100% 13.200 9.240 N BIN1 n/a
9 TRCN0000307309 AGTGTCTGCAGGAGGTGTATG pLKO_005 462 CDS 100% 10.800 7.560 N BIN1 n/a
10 TRCN0000379889 GGGCGTTCTCCCAAAGATTAG pLKO_005 1797 3UTR 100% 10.800 7.560 N BIN1 n/a
11 TRCN0000382367 TCAAAGCCCAGAAGGTGTTTG pLKO_005 747 CDS 100% 10.800 7.560 N BIN1 n/a
12 TRCN0000307310 TGTGTCCTCTAGTTGAGTTTC pLKO_005 1882 3UTR 100% 10.800 7.560 N BIN1 n/a
13 TRCN0000382219 TTGAAGAGCAAAGGGAAATCA pLKO_005 1755 3UTR 100% 5.625 3.938 N BIN1 n/a
14 TRCN0000118040 GAGACCAAGGATGAGCAGTTT pLKO.1 323 CDS 100% 4.950 3.465 N BIN1 n/a
15 TRCN0000118041 CAAGCTCAACCAGAACCTCAA pLKO.1 889 CDS 100% 4.050 2.835 N BIN1 n/a
16 TRCN0000382225 GAGCAACACCTTCACGGTCAA pLKO_005 943 CDS 100% 4.050 2.835 N BIN1 n/a
17 TRCN0000118038 CCAGGTTTCATGTTCAAGGTA pLKO.1 1433 CDS 100% 3.000 2.100 N BIN1 n/a
18 TRCN0000382240 GGCAAACAAGATCGCAGAGAA pLKO_005 508 CDS 100% 4.950 2.970 N BIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139348.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.